Skip to content

RIKEN BRCExperimental Plant Division

Shrunk Expand

Primary Navigation

  • TOP
    • Experimental Plant Division Top
    • Japanese
    • RIKEN
    • RIKEN BioResource Research Center
    •  Experimental Animal Division
    •  Cell Engineering Division
    •  Gene Engineering Division
    •  Microbe Division
    • News
    • Outline of Experimental Plant Division
    • Link
  • Resources
    • Resource List
    • Catalogues
    •   ▶ Seed Catalog
    •   ▶ Plant DNA Catalog
    •   ▶ Plant Cells
    • RIKEN BRC Reference list
    • User’s Guide
  • Distribution
    • Overseas Distribution
    • User Registration
  • Technical Notes
    • Resource Handling
    • Technical Notes
  • Mailnews
    • MAIL NEWS Back Number
  • Contact Information
    • Questions about Plant Resources
    • Inquiry about Payment
TOP > Technical Notes & Resource Handling > Technical Notes

Technical Notes

Maps for RAFL clones Maps for RAFL clones

Sequence of pPCVICEn4HPT Sequence of pPCVICEn4HPT (RB→backbone→LB→T-DNA→RB; Duplicated
sequence (CTAGATCCGAAACTATCAGTG) at both ends was used as a primer.)



 

Comments are closed.


  • Stock Searching

    Exp-Plant Catalog
    Keyword(s):
      
  • Our Project

    ▶ About RIKEN BRC

    ▶ Information for users

    ▶ For general public

  • Biological Resources

    ▶ Seed Catalog

    ▶ Plant DNA Catalog

    ▶ Plant Cells

  • How to Order

    Step 1 User Registration

    Step 2 Documents

    Quality Control

    Step 3 Payment

    Step 4 Shipping

    Terms of Use

  • Resource List

    Arabidopsis thaliana Arabidopsis thaliana
    Brachypodium Brachypodium distachyon
    populus Populus nigra
    oryza Oryza sativa
    lotus Lotus japonicus
    lycopersicom Lycopersicon esculentum Mill
    striga Striga hermonthica
    nicotiana Nicotiana tabacum
    (BY-2 cell)
    brassica Brassica rapa
    thellungiella Thellungiella halophila
    physcomitrella Physcomitrella patens
    manihot Manihot esculenta Crantz
    • TOP
      • Experimental Plant Division Top
      • Japanese
      • RIKEN
      • RIKEN BioResource Research Center
      •  Experimental Animal Division
      •  Cell Engineering Division
      •  Gene Engineering Division
      •  Microbe Division
      • News
      • Outline of Experimental Plant Division
      • Link
    • Resources
      • Resource List
      • Catalogues
      •   ▶ Seed Catalog
      •   ▶ Plant DNA Catalog
      •   ▶ Plant Cells
      • RIKEN BRC Reference list
      • User’s Guide
    • Distribution
      • Overseas Distribution
      • User Registration
    • Technical Notes
      • Resource Handling
      • Technical Notes
    • Mailnews
      • MAIL NEWS Back Number
    • Contact Information
      • Questions about Plant Resources
      • Inquiry about Payment

  •  

    Experimental Plant Division / RIKEN BioResource Research Center
    3-1-1 Koyadai, Tsukuba, Ibaraki 305-0074, Japan
    Phone:+81 29 836 9067
    Fax:+81 29 836 9053
    E-mail:plant.brc@riken.jp


Copyright © 2023 Experimental Plant Division - All Rights Reserved
  • TOP
    • Experimental Plant Division Top
    • Japanese
    • RIKEN
    • RIKEN BioResource Research Center
    •  Experimental Animal Division
    •  Cell Engineering Division
    •  Gene Engineering Division
    •  Microbe Division
    • News
    • Outline of Experimental Plant Division
    • Link
  • Resources
    • Resource List
    • Catalogues
    •   ▶ Seed Catalog
    •   ▶ Plant DNA Catalog
    •   ▶ Plant Cells
    • RIKEN BRC Reference list
    • User’s Guide
  • Distribution
    • Overseas Distribution
    • User Registration
  • Technical Notes
    • Resource Handling
    • Technical Notes
  • Mailnews
    • MAIL NEWS Back Number
  • Contact Information
    • Questions about Plant Resources
    • Inquiry about Payment
  • RIKEN BRC
  • NBRP