Please consider joining Concurrent session 8, Research tools and resources in the International Conference on Arabidopsis Research (ICAR2010). Also, please visit RIKEN BRC booth which will be open fro…
- Category Archives News
-
-
Additional pool sets of RIKEN Arabidopsis activation-tagged line (pss) are now available
Total 4 pool sets (1,000 lines/pool set) of RIKEN activation-tagged lines established in RIKEN GSC are ready for distribution. Please find detailed information for this resource here. (2010/4/21)
-
Discount Service for Independent seeds, Pooled seeds and Independent plant DNA
We have already announced that the old fees were revised and the new fees were in effect after 08:00 GMT on March 19, 2010 through the BRC Website. It was executed due to the release of new resources…
-
Catalogue of natural accessions from SASSC is revised
The number of natural accessions on the catalogue is increased. From Advanced Menu, photo image list is available. Expanded image appears when you click the image. You can visit the catalogue from her…
-
Catalogue of individual mutant and transgenic lines is opened
A list of mutant and transgenic lines is now available from here. (2009/12/28)
-
List of homozygous RIKEN Arabidopsis transposon-tagged mutants recently added to our catalogue. (5)
Line Name 11-0411-1 11-0413-1 11-0430-1 11-0459-1 11-0468-1 11-0474-1 11-0528-1 11-0536-1 11-0543-1 11-0556-1 11-0563-1 11-0567-1 11-0568-1 11-0572-1 11-0574-1 11-0583-1 11-0590-1 11-0593-1 11-0607-1…
-
List of homozygous RIKEN Arabidopsis transposon-tagged mutants recently added to our catalogue.(5)
We have released homozygous seeds for 329 lines of RIKEN Arabidopsis transposon-tagged mutants. Please read the following information and email to plant.brc@riken.jp if you have any question. You can…
-
Available number of FOX line seed pool sets is increased.
The available number of pool set for Arabidopsis FOX lines is now increased to 5 (equivalent with 5,000 lines, suitable for phenotype screening). More information for this resource is here. (2009/10/2…
-
Resource List
Full-length cDNA sequence of Thellungiella halophila obtained by NBRP. #Thalophila AGI_CODE Description Sequecne GCT-001A01 AT1G16720.1 oxidoreductase/ transcriptional repressor GAGTGACAGATTAGCATGCAAA…
-
Revision of catalogues for tobacco EST clones from BY-2 cells
We have revised the catalogues for tobacco EST clones from BY-2 cells. Some of the clones added are full-length cDNA. The new clones will be also added to the SABRE database. (2009/10/1)
