How to Order

Step 1 User Registration

Step 2 Documents

Quality Control

Step 3 Payment

Step 4 Shipping

Resource List

Arabidopsis thaliana Arabidopsis thaliana
Brachypodium Brachypodium distachyon
populus Populus nigra
oryza Oryza sativa
lotus Lotus japonicus
lycopersicom Lycopersicon esculentum Mill
striga Striga hermonthica
nicotiana Nicotiana tabacum
(BY-2 cell)
brassica Brassica rapa
thellungiella Thellungiella halophila
physcomitrella Physcomitrella patens
manihot Manihot esculenta Crantz

Technical Notes

Maps for RAFL clones Maps for RAFL clones

Sequence of pPCVICEn4HPT Sequence of pPCVICEn4HPT (RB→backbone→LB→T-DNA→RB; Duplicated
sequence (CTAGATCCGAAACTATCAGTG) at both ends was used as a primer.)